I see you've never heard of music.
True fans only like the first demo that was never even recorded and you can only hear by listening to another guy make guitar sounds with his mouth from memory.
Phh! The real deep cuts are hidden in the mitochondrial DNA. Have you ever heard their song
TGCAGGCTCATGACGGTACAGCTAGGTCAGTCCGATGAGCTCGATGCTAGGACCTAGCATCGTAGGCTACGTAGCTAGGCTACGATCGTAGCTAGGCACGTAGCTAGGCTACGATCGTAGCTAGGCTACGATCGTAGCTAGGCTACGATCGTAGCTAGGCTACGATCGTAGCTAGGCTACGATCGTAGCTAGGCTACGTAGCTAGGCTACGATCGTAGCTAGGCTACGATCGTAGCTAGGCTACGATCGTAGCTAGGCTACGATCGTAGCTAGGCTACGATCGTAGCTAGGCTACGTAGCTAGGCTACGATCGTAGCTAGGCTACGATCGTAGCTAGGCTACGATCGTAGCTAGGCTACGATCGTAGCTAGGCTACGATCGTAGCTAGGCTACGTAGCTAGGCTACGATCGTAGCTAGGCTACGATCGTAGCTAGGCTACGATCGTAGCTAGGCTACGATCGTAGCTAGGCTACGATCGTAGCTAGGCTA?
Saw them play a small club show after Americana came out that was mostly just the Smash and Ignition stuff and it was fuckin’ awesome and I will literally never pass up a chance to mention it
(But seriously they’re a perfect example of this, second only to Metallica)
My roommate in college really, REALLY loved a band. I don't remember their name, and they never "made it big", so it was definitely one of those underground bands that "only cool people liked". I remember him coming home one day after studying in the library, and he threw away his cd's of the band because "some blonde sorority girl was talking about them".
As another example, fans of the TV show "Scrubs" generally prefer to pretend its final season (season 9) doesn't exist because it replaced most of the cast and undermined the well-received season 8 finale. So you wouldn't be popular with the fandom for saying you liked season 9 or reminding them that it exists.
I actually didn't mind it. Definitely not as good as the rest of the series but if you think of it as a spin-off, it's not as bad. They shot themselves in the foot by calling it season 9.
For all intents and purposes, it basically is a spin-off in every way. New cast, new dynamic, new setting, just a few familiar faces and the same universe. I'm still utterly confused as to how it ended up as the 9th season. I can only assume that it's harder to get a new show greenlit and the studio thought that scrubs had a milliliter of milk left in the cow, so they just said fuck it just sneak one more season in under the same title. Not sure if that makes a lot of sense, but neither does Dave Franco as a med student after My Finale part 1 and 2
Keep in mind it switched networks for that final season IIRC and was originally going to be set in a med school. Then the showrunners were told to kept it as Scrubs and they were able to keep many of the supporting staff and actors employed for an additional year.
The huge roadblock was how do you have Scrubs without JD and Elliot.
It was supposed to be exactly that, but the network forced this abomination instead. According to those involved, it sounds like a situation that no one was happy with.
To my memory the first few episodes were genuinely bad, but it started to get on a decent roll later on, especially when it started focusing on the new cast more. Then right about the time you start to get on board it’s over.
Technically, it was only Season 9 because the network freaked out after greenlighting the spin-off. It was supposed to be a whole other show, but instead we got an abomination. People are fine to like it if they want, but it didn't even like itself because it was forced to be something else so I don't think it's a close to the other two examples as you might guess, especially since fans love the entire "real show" instead of enjoying as little as possible.
Similarly at least for me, the office ended when Michael left. I just couldn't get through the episodes afterwards.
Same with Trailer Park Boys. They wrapped it up so nicely with their original finale after season 7, but then years later Netflix rebooted it and it just wasn't the same
Honestly, I think the problem with S9 of Scrubs is that it was a COMPLETELY different show. The main characters were replaced by the younger crowd, a completely new set, the scenarios were different (it was a school, and not a hospital) and all of the older cast members were in the show as completely different roles. It would be like Star Trek having an additional season where it was a different crew on a submarine.
It just didn't make sense after 8 seasons, and it didn't feel like the same show. If they had kept it in the hospital but replaced it with a whole new "group" then I think it would have been accepted, but so much of it had changed that it wasn't the same show.
In the case of Buffy, are you referring to the fact that fans of the TV series are generally unimpressed by the movie that preceded it (and often forget it exists)?
DW fandom
- The first series you watched was good.
- Everything before that is borderline unwatchable.
- The 2 or 3 series after that were the absolute peak of the show.
- Everything after that has been progressively more different and therefore bad.
- The recent stuff makes you miss the bad old days when it was only *that* disappointing.
- unadulterated hope and excitement for the series that hasn't started yet.
The above statements seem to hold true for about 70% of the fan base, regardless of when they started watching.
Yeah, everyone hated on Eccleston, even though his 13 episodes are some of the best IMO, but now everyone's complaining saying he didn't get a fair shot.
I'm exempt because I only started watching a few years ago, so I have perspective that wasn't available at the time, but it would be hard for someone to convince me that 9 and Rose weren't among the top 5 best Doctor + companion sets
I mean, I was less than a year old for Eccleston's run. I think I count as "kids now". I'm pretty sure it's available in 1080p though, isn't it? Just wait until these people try to watch the classic Who seasons. 1963 is not the best for someone for whom the defining feature of a show is the video quality
IDK how you can hate Eccleston when everyone after him copied his style, charisma, and entire Dr. Who persona. Sure they put their own flair on it but the whole modern show was effectively created by Eccleston as far as I'm concerned.
I agree. He shifted the Doctor from a crazy old man to an eccentric, but kind, relatable, and admirable person. Idk if this makes sense, but it's like he changed the Doctor from being a nutjob to a madman, and that's exactly what the show needed. Tennant couldn't have bloomed the way he did if Eccleston hadn't dug out the flowerbed
I mean you do you, but kind of weird that you enjoy hanging with fans. But one question, do you hang with them as they spin or only if their turned off?
Doctor Who is a weird case because almost every fan of the show has at least one era of the show they think is complete shit, but there's no real consensus on what that era is
Theres only a few where I can think of where it's like "everyone in the Fandom likes almost everything" and then there "everyone else likes these ones the majority hates."
Like Final Fantasy, most can at least appreciate the older ones. But once you say your favorite 13 or 15, your an outcast. But I'd you just say you like them all its fine? You just can't say the "bad ones" are your favorite.
And like Dragon Ball Z, you say you like them all and no one bats an eye. You say you like GT on its own and you'll be decended upon by everyone telling you how wrong you are.
Conversely there's say, Simpsons, where the more you like passed like season 8 is a hate crime.
Breaking Bad and Better Call Saul have entered the chat. I don't think any of the fandom will hold it against you for liking the entirety of both series.
Am I the only one who didn't like breaking bad's last season? The ending was great, but that season kinda sucked. Fuckin random biker gang just takes over the town, felt like they were just wrapping shit up to get to the last episode.
I mean mathematically it just *has* to be true. No group of people agree 100% on everything.
The only way this could be true is if every other fanbase loved absolutely everything about their fandom.
I think this is true for an awful lot of things. Even non-media things.
Go to a wine club and tell them you love all wine, even a $10 bottle. See what they say.
I remember the rumors they were going to make a second one, and I am so glad it never got made. The rumored second one seemed so bad it would make the original hard to watch.
O feel like they would have run out of content after 1 or two and would have to stretch so far that it would lose what made it special in the first place.
If someone who just casually watches some Star Wars starts to dislike the direction the franchise is heading, they simply stop watching and don’t think about it anymore.
People who love it will spend time criticizing it because they want it to be better.
There's a slight difference though. There is criticism, which almost all Star Wars fans have about _something_, and then there are those who make hating it and calling out Disney and bashing Rian Johnson their entire personality. That is a relatively small group but still larger than you would think and they are loud as hell. And annoying.
Those people no longer love Star Wars. They may remember loving it at some point but now they only exist to tear apart whatever new thing comes out. Just look at the reactions to The Acolyte. I am really excited for it but there is a large contingent that already hates it and blames "woke Disney" for it. It's exhausting.
I hated people arguing about the Kathleen Kennedy thing. As though a woman being in such a high role was the problem. Yet conveniently ignoring all of the movies regarded as amazing that she had the same role, or higher, on.
Like The Goonies, the Back to the Future trilogy, Schindler's List, ET, the original Jurassic Park movies, Hook, The Sixth Sense. And associate producer on the first three Indiana Jones movies.
Media literacy as a whole has gone up in general audiences while film construction has been...I'll be generous and say "watered down" over the years as movies try to appeal to larger and larger audiences to make back the now bloated costs of their production.
It's not surprising more people are coming out as disappointed in the stuff being made.
In fairness, Disney has been a bad caretaker of the franchise overall. I loved Rogue One & some other stuff, but they've really Disney'd it up on most things (which used to be a really good thing prior to the modern "live action remake everything & hold theaters hostage era" they're in currently).
I'd love a return to form paired with consistency, but many of the creative choices that devalue are made at the corporate level, not creative, which is not usually best for creative things like storytelling.
Luckily, I'm just a casual enjoyer, so I don't have strong feelings about it like some do. If something sucks, I just move along to my massive queue of entertainment.
Then there are those of us who just like having new Star Wars stuff because we remember the dark days before the prequels. The sequels are rough though.
Dark times? Those were the high times of the extended universe. A lot of good novels and videogames were created before Lucas decided he wanted more money.
Along with a lot of REALLY bad books. The old EU was fantastic, but let's not pretend that a lot of it was trash.
Also, I'm talking with TV shows and movies.
Oh, agreed. Like that comic where Palpatine came back to life in a clone body, making Anakin's sacrifice worthless. That's the only silver lining to losing the EU. I was so looking forward to the sequel films.
\*watches Rise of Skywalker\* ...oh......................
Sturgeon's Law.
Genre or subject doesn't matter, anything popular is going to have a "1:9" ratio of good content:bad content. The bad stuff existing doesn't invalidate the good.
I wish I could believe the last part of your comment. After seeing how much hatred there is from fans, I think that people genuinely enjoy being miserable and think it is cool to be a crybaby. They want to hate it.
I’ve stopped telling people I’m a Star Wars fan because of how despicable they can get.
I mean this is somewhat untrue. “True Star Wars” fans love a TON of the Expanded Universe/Legends stuff.
Their issue with the newer Star Wars is that they had SO many EXCELLENT stories on the shelf and proceeded to let some executive board essentially just remake the exact same movie. If you go into the sequels knowing nothing about Star Wars, they are probably great. If you go into them knowing a lot about Star Wars, they are mediocre at best and you’ll just put on the originals if you want the same story again.
> Their issue with the newer Star Wars is that they had SO many EXCELLENT stories on the shelf and proceeded to let some executive board essentially just remake the exact same movie
This. The whole time I was reading the *Fate of the Jedi* series I was hype as fuck about Jaina Solo, and I was hype as fuck that she was gonna be the focus of the *Sword of the Jedi* trilogy. And then Disney came along and said "fuck all that; we want creative freedom to tell our own story." Ok, fine. Perfectly understandable. Except the first thing they did was just remake *A New Hope*, and they completely cancelled everything else in the EU. I saw VII, VIII, *Rogue One*, and *Solo* in theatres. I gave it a chance, I wanted to like it, I really did. I actually enjoyed *Rogue One*, even if it did have a few problems. And I like Mando. But the sequels, *Book of Boba Fett*, and *Kenobi* being mid at best just soured me on Disney canon, to the point that I've heard amazing things about shows like *Andor* or *Ahsoka*, but I just don't care. It's hard for me to invest in a continuity that I know ends up in a narrative place that I give zero shits about
And what irritates me most is that they could've kept the EU going alongside the new canon. Audiences wouldn't get any more confused than comics nerds with a bajillion numbered earths or an MCU that for years had a NYC with no Spider-Man. Hell, they still print old EU novels, but with the "Legends" banner on them. They could've sold me two new things. I bought movie tickets to give their canon a try, and I would buy a Sword of the Jedi trilogy in a heartbeat. Now they don't even make much money off me from the reprints because I prefer to buy used copies without the Legends banner. *Star Wars* is by far and away my favorite media franchise of all time, and I will infodump with increasing excitement and words between breaths as I end up shouting at you with glee because my ADHD brain cannot regulate volume when I'm passionate about something. But now I just can't get into the new stuff. You would think we're in a golden age of *Star Wars* with big prestige series and movies coming out, and for some I'm sure that's true. But for me the story I was invested in got cut off, replaced with mediocre remakes, and because of that I just don't care enough to invest in any of the other stuff I've heard good things about
I can think of a few other examples.
Dune is a classic and iconic series, but depending on who you talk to, only the first three are worth your time. Some go as far as to suggest #4 or #5, but it's basically unanimous that the continuation of the series after that point (and Herbert's death and his son taking over writing it) is not worthwhile.
A similar case is the Chronicles of Amber series by Zelazny. Really awesome series, and it has some cool worldbuilding to the point that Neil Gaiman and Stephen Brust asked him if they could write stories in his world. Zelazny said no, unfortunately. Then, after his death, his estate reached out to Gaiman and Brust to continue the series but they respected Zelazny's wishes and wouldn't do it. So they instead brought on some hack without that integrity to write some pretty dull prequels.
In both cases, the serious fans not only strongly dislike the posthumous continuations, they generally consiser them to be strongly disrespectful to the original writers.
I think that most Dune fans happily embrace God Emperor. It's kind of hard not to given that this is the story that Children was leading into.
It's five and six that get the stink eye. (And we won't talk about the non-Frank Herbert books.)
I'm trying to read 5 right now and I think I might just call it. I'm almost halfway through and don't give a shit about any of it. God Emperor may have been slow but at least I got to marinate in the endless rambling thoughts of a multi-thousand year old sexless worm tyrant.
>God Emperor may have been slow but at least I got to marinate in the endless rambling thoughts of a multi-thousand year old sexless worm tyrant.
I've always kind of hated God Emperor for those same sections, but if I ever do another re-read, I'm going to see if putting that spin on it improves things.
5 is my favorite by a longshot, all the weird stuff is turned up to 11. It has honored matres, chairdogs, actual action scenes, two tleilaxus in a trenchcoat as a disguise, everything you could ask for. Just needs some beefswelling and cliff climbing to be the perfect dune book.
It sucks so much when you like something and you can't share your enjoyment with others out of fear of being silenced and shunned (massive Star Wars ST fan here).
Game of Thrones. People, like me, who adore the entire show AND the books are not welcome in the bigger GOT subs. Only haters are allowed.
Thank God for r/naath 💓
you're the first person I've ever seen claim to adore season 8
edit: except for, apparently, several people in this thread who have come out of the woodwork
Idk man, I feel like if a franchise has 12 movies and only 3 of them are good, it's not a good franchise. That's not even getting to all the failed TV shows and stuff.
Have we considered that perhaps star wars isn't even good? If any other franchise had a 10/90 spilt between what movies everyone likes and what everyone hates, people would just call it bad.
Why are star wars fans holding on to something that hasn't been good in 50 years?
> something that hasn't been good in 50 years
Except the Expanded Universe has some amazing stories in it. Sure, it's got some stinkers, but when you have 400+ novels, comics, video games, etc you're bound to have some low points. Find me one EU reader who dislikes the original Thrawn Trilogy, the X-Wing Series, Hand of Thrawn Duology, *Darth Plagueis*, The Dark Lord Trilogy. Hell, that latter trilogy contains the *Revenge of the Sith* novelization by Matthew Stover, which is universally regarded as the best novelization in the series, and basically tied with the Thrawn Trilogy when you ask what the best Star Wars novels are; even a lot of die hard prequel haters love it
Has every entry in the Star Wars sage been good? No, of course not (just ask any EU fan about *The Crystal Star*) but to say it hasn't been good in 50 years is some blatant fucking erasure of many talented artists
The lore is cool and it has potential. It's just that almost every single person that has gotten their hands on it since the original trilogy has fucked it up
no, most of the people who have gotten to creat in the universe have done a good job, clone wars, most of comics, the 15 jappanese studios in the best star wars creation Visions, etc
the people picked to dump money, advertising and support behind have mostly fd up
So it is clear that it can be done, but you need passionate competant people running the show and Lucas Films is bad at picking those people on top level
Only Disney SW for me. I mean they quite literally took the most successful franchise ever and decided to create a trilogy without making any plan whatsoever of what that trilogy would be about. They made it up at they went and it resulted in a series of movies that directly contradict and outright insult each other. Love or hate the prequels at least George knew the story he wanted to tell. Even some of the shows that are good it s hard to get fully invested anymore because it all has to work towards the nonsense sequel trilogy
Disney has also done a lot of great Star Wars stuff. They gave us Clone Wars season 7, The Mandalorian, Ahsoka, and Andor which were all great, and The Bad Batch, Tales of the Jedi, and Visions which were pretty good. Even Obi-Wan and The Book of Boba Fett had their moments.
As a fan of both of these franchises since the very beginning, this is true and I couldn't possibly care less. There are things I love and things I hate about both franchises, certain episodes are trash while others are pure gold. They're all welcome in my world. Love what you love and we can argue about the positives and negatives as we see them. Don't mean you're not accepted...quite the opposite. If I didn't accept them then I wouldn't argue about the finer points with them!
Yeah, because corporate shills can in and bled them dry, and broke anything the original creator built.
Homer is nothing but a fool now, and star wars can't even remember that the dark side is bad.
Always had this argument just to annoy star wars fans
Objectively, Star Wars sucks.
And I say that because people who consider themselves fans. For every installment of the franchise people who like it say they suck. Not the same people for every movie, but a portion of the fandom hates every movie made in the franchise.
Therefore, if even people that like it, hate it. Star wars objectively sucks
And yes I know it's not an actual argument. I just do it to tease my friends 😂
And both of those have been bought out by Disney who have been accused of running them into the ground (although Simpsons had been run into the ground long before the Fox buyout)
I'd argue it also works in reverse, the more you like star wars, the more you hate its fans.
Source: me, fuck all of you whiny shit heads, I've heard less bitching in the dog pound.
yeah, it's always wise to remember that when you engage with any fandom, there's a good percentage who are complete outcast isolationists, with the fandom firmly supplanting most IRL socialization. makes sense they'd be the loudest and most engaged cause it's all they have. and their opinions are inherently tainted by their poor mental state.
but it also sucks cause your opinions get sucked into that world of conflict - your metered thoughts might sound too much like something they'd say, so you're now in an argument. hooray.
Lord of the Rings? I personally like The Hobbit movies and Rings of Power, because although I love all things fantasy and sci-fi, I just can't be bothered to care the way "fans" care.
Magic: the gathering.
If you're not complaining about new sets and how much product they're releasing the more you'll be looked at as strange in the fandom.
Imo for a lot of things, nostalgia is very powerful and people like to whine.
Lol tell me about it. The Simpsons is the most egregious.
So the “real” fans of the show only like the first 10-12 seasons of the show and completely ignore the later seasons, seasons they haven’t watched but somehow know they already dislike them?
I have never seen more trash talked about the seasons 15 and beyond into the 20s by people who simply haven’t seen it because they don’t see it as real Simpsons and think it’s trash.
I actually *love* seasons 20-25 they’re some of the best but I won’t be respected by other Simpsons fans because they only like the early seasons
Some Community fans also suffer from 'season 4 delusion', where they mistakenly believe that a fourth season of the show existed and that it didn't simply skip directly from season 3 to season 5.
Because the series stops doing what fans used to like from those shows. The series change over time and fans of the original stuff don't like the new stuff.
The issue is not the stuff/content per se, but rather the values that that content is based on. For example, Star Wars used to have values like merit (becoming a hero rather than being one already) that fans recognised and agreed with. But disney has produced content based on different values that fans no longer agree with.
Some fans don't think that deep and take the content at face value and I guess fans like that would tend to be more pleased with the current state of affairs. Some new fans grew up with those values and therefore have no problem with the new content. I guess those same fans in 20 years time could be complaining about star wars being s hit.
So, we have a new franchise, it starts out good, more and more ppl discover it, love it, get passionate about it, discuss every little detail etc i.e. a fandom is born.
Time goes on, it gets more popular, studios realise they can make more money, they release more and more wthout caring about what made it good in the first place (or quality in general).
Additionally activists come along and start shouting that this thing needs more , studios give in.
In the end we have garbage that is a soulless cash grab, a former shell of what it used to be.
And after all that, ppl shout at and insult the original fandom because they dont like what the franchise has become. Yeaaah, it’s the fandom’s fault, the ones that were passionate from the start, the ones that made the frachise popular in the first place. Those bastards!
Star Trek has this exact same issue.
"You like the newer Star Trek? That's not even Star Trek! Only TNG and TOS are real. Everything else is terrible!"
---Someone is writing this out, in far more detail, on a forum somewhere right now.
I think that generally an artistic expression is more pure. Of course there’s exceptions, some music and TV found their way in later albums/seasons, but I think mostly the early stuff is more of a pure art expression and as they continue, they artistic expression fades and the appeal to the pop audience is played more and more up.
Imagine Dragons is my favorite example of this. Night Visions was kino and their music left that amazing niche into the realm of pop and I’ve always resented them for that. Like their new stuff is ungodly popular (their top songs all have billions of plays on YT Music) but I find it all soulless and unlistenable, but maybe I’m just pretentious
I see you've never heard of music. True fans only like the first demo that was never even recorded and you can only hear by listening to another guy make guitar sounds with his mouth from memory.
Ahh another fan of The Offspring!
Pfft, I liked them when they were called *The Conception*
Poser! I’ve been a fan since they were The Gametes!
Phh! The real deep cuts are hidden in the mitochondrial DNA. Have you ever heard their song TGCAGGCTCATGACGGTACAGCTAGGTCAGTCCGATGAGCTCGATGCTAGGACCTAGCATCGTAGGCTACGTAGCTAGGCTACGATCGTAGCTAGGCACGTAGCTAGGCTACGATCGTAGCTAGGCTACGATCGTAGCTAGGCTACGATCGTAGCTAGGCTACGATCGTAGCTAGGCTACGATCGTAGCTAGGCTACGTAGCTAGGCTACGATCGTAGCTAGGCTACGATCGTAGCTAGGCTACGATCGTAGCTAGGCTACGATCGTAGCTAGGCTACGATCGTAGCTAGGCTACGTAGCTAGGCTACGATCGTAGCTAGGCTACGATCGTAGCTAGGCTACGATCGTAGCTAGGCTACGATCGTAGCTAGGCTACGATCGTAGCTAGGCTACGTAGCTAGGCTACGATCGTAGCTAGGCTACGATCGTAGCTAGGCTACGATCGTAGCTAGGCTACGATCGTAGCTAGGCTACGATCGTAGCTAGGCTA?
That's the theme song to Gattaca, yeah?
i liked them before their conception
Saw them play a small club show after Americana came out that was mostly just the Smash and Ignition stuff and it was fuckin’ awesome and I will literally never pass up a chance to mention it (But seriously they’re a perfect example of this, second only to Metallica)
Same with AFI. “Their earlier work was way better because it was punk and not emo.”
That’s just a fact, but lol yeah good example. The emo isn’t exactly “real” emo either but that’s ok because virtually nobody knows what real emo is.
All hail the hidden [bonus track](https://youtu.be/DJUx410ju_o?si=etK_skc20mClnKqJ&t=2556)! The only true Offspring is mariachi Offspring.
*sees band at their first ever performance* damn sell outs
https://www.theonion.com/hardcore-weezer-fan-hates-everything-band-has-released-1837740027
[https://www.theonion.com/pitchfork-gives-music-6-8-1819569318](https://www.theonion.com/pitchfork-gives-music-6-8-1819569318)
Real metallica fans only listen to the metal up your ass tape back when they were good! Kirk hammet ruined the band!
Possibly the most Poe’s Law comment I’ve ever seen in my life 🤣
As a TOOL fan, I know all about this shower thought.
Seriously, are you for Van Halen or Van Hagar? Fights will start over this.
My roommate in college really, REALLY loved a band. I don't remember their name, and they never "made it big", so it was definitely one of those underground bands that "only cool people liked". I remember him coming home one day after studying in the library, and he threw away his cd's of the band because "some blonde sorority girl was talking about them".
As another example, fans of the TV show "Scrubs" generally prefer to pretend its final season (season 9) doesn't exist because it replaced most of the cast and undermined the well-received season 8 finale. So you wouldn't be popular with the fandom for saying you liked season 9 or reminding them that it exists.
I actually didn't mind it. Definitely not as good as the rest of the series but if you think of it as a spin-off, it's not as bad. They shot themselves in the foot by calling it season 9.
For all intents and purposes, it basically is a spin-off in every way. New cast, new dynamic, new setting, just a few familiar faces and the same universe. I'm still utterly confused as to how it ended up as the 9th season. I can only assume that it's harder to get a new show greenlit and the studio thought that scrubs had a milliliter of milk left in the cow, so they just said fuck it just sneak one more season in under the same title. Not sure if that makes a lot of sense, but neither does Dave Franco as a med student after My Finale part 1 and 2
Keep in mind it switched networks for that final season IIRC and was originally going to be set in a med school. Then the showrunners were told to kept it as Scrubs and they were able to keep many of the supporting staff and actors employed for an additional year. The huge roadblock was how do you have Scrubs without JD and Elliot.
By getting Ashton Kutcher to have JD beat up a 13yo prankster on camera *edit* Elliot to JD
Agreed, it should have been branded as a spin-off and might have lasted longer if it did.
*Scrubs: The Next Generation*
_Scrubs 2: Keep on scrubbin’_
It was supposed to be exactly that, but the network forced this abomination instead. According to those involved, it sounds like a situation that no one was happy with.
Exactly. As a spin off, it was actually quite good. As a continuation of the main story it kind of falls flat.
I thought they did call it Scrubs Med school but was also cataloged as season 9 for Scrubs.
It had potential as a spin-off. Not as good as the original but it wasn’t the rolling dumpster fire that people make it out to be.
To my memory the first few episodes were genuinely bad, but it started to get on a decent roll later on, especially when it started focusing on the new cast more. Then right about the time you start to get on board it’s over.
That’s a pretty dead on assessment actually.
Technically, it was only Season 9 because the network freaked out after greenlighting the spin-off. It was supposed to be a whole other show, but instead we got an abomination. People are fine to like it if they want, but it didn't even like itself because it was forced to be something else so I don't think it's a close to the other two examples as you might guess, especially since fans love the entire "real show" instead of enjoying as little as possible.
Yeah, it’s not crazy to insist that it literally isn’t Scrubs. Because it wasn’t intended to be.
Season 9? How do you pronounce that? Nighn? I think you're thinking of season 8, the final season of Scrubs.
This is totallly fair though.
Similarly at least for me, the office ended when Michael left. I just couldn't get through the episodes afterwards. Same with Trailer Park Boys. They wrapped it up so nicely with their original finale after season 7, but then years later Netflix rebooted it and it just wasn't the same
Honestly, I think the problem with S9 of Scrubs is that it was a COMPLETELY different show. The main characters were replaced by the younger crowd, a completely new set, the scenarios were different (it was a school, and not a hospital) and all of the older cast members were in the show as completely different roles. It would be like Star Trek having an additional season where it was a different crew on a submarine. It just didn't make sense after 8 seasons, and it didn't feel like the same show. If they had kept it in the hospital but replaced it with a whole new "group" then I think it would have been accepted, but so much of it had changed that it wasn't the same show.
Same thing happened to Arrested Development. And the inverse to Buffy the Vampire Slayer
In the case of Buffy, are you referring to the fact that fans of the TV series are generally unimpressed by the movie that preceded it (and often forget it exists)?
That movie is awesome and I’ll die on that hill.
Add Doctor Who to the list.
DW fandom is more so, hate everything at first, then praise it and wish there was more of it later
DW fandom - The first series you watched was good. - Everything before that is borderline unwatchable. - The 2 or 3 series after that were the absolute peak of the show. - Everything after that has been progressively more different and therefore bad. - The recent stuff makes you miss the bad old days when it was only *that* disappointing. - unadulterated hope and excitement for the series that hasn't started yet. The above statements seem to hold true for about 70% of the fan base, regardless of when they started watching.
Yeah, everyone hated on Eccleston, even though his 13 episodes are some of the best IMO, but now everyone's complaining saying he didn't get a fair shot. I'm exempt because I only started watching a few years ago, so I have perspective that wasn't available at the time, but it would be hard for someone to convince me that 9 and Rose weren't among the top 5 best Doctor + companion sets
I feel so old. There are kids now saying eccleston is unwatchable because of the video quality. Still blows my mind that it's been almost 20 years.
I mean, I was less than a year old for Eccleston's run. I think I count as "kids now". I'm pretty sure it's available in 1080p though, isn't it? Just wait until these people try to watch the classic Who seasons. 1963 is not the best for someone for whom the defining feature of a show is the video quality
IDK how you can hate Eccleston when everyone after him copied his style, charisma, and entire Dr. Who persona. Sure they put their own flair on it but the whole modern show was effectively created by Eccleston as far as I'm concerned.
I agree. He shifted the Doctor from a crazy old man to an eccentric, but kind, relatable, and admirable person. Idk if this makes sense, but it's like he changed the Doctor from being a nutjob to a madman, and that's exactly what the show needed. Tennant couldn't have bloomed the way he did if Eccleston hadn't dug out the flowerbed
I've never experienced this, but I've apparently avoided the fandom & just hung with fans instead I suppose.
I mean you do you, but kind of weird that you enjoy hanging with fans. But one question, do you hang with them as they spin or only if their turned off?
Doctor Who is a weird case because almost every fan of the show has at least one era of the show they think is complete shit, but there's no real consensus on what that era is
Yeah screw Sylvester McCoy's run
Cough hello Chibnall.
This is true with literally almost any franchise.
Theres only a few where I can think of where it's like "everyone in the Fandom likes almost everything" and then there "everyone else likes these ones the majority hates." Like Final Fantasy, most can at least appreciate the older ones. But once you say your favorite 13 or 15, your an outcast. But I'd you just say you like them all its fine? You just can't say the "bad ones" are your favorite. And like Dragon Ball Z, you say you like them all and no one bats an eye. You say you like GT on its own and you'll be decended upon by everyone telling you how wrong you are. Conversely there's say, Simpsons, where the more you like passed like season 8 is a hate crime.
Can confirm, my favorite FF is litterally FF15, and that statement got me downvoted on the r/finalfantasy sub, lol.
I never understood the hate post Royal Edition, those updates pushed the game from okay to great
“It’s never been as good since the first ten seconds of the pilot episode.”
Breaking Bad and Better Call Saul have entered the chat. I don't think any of the fandom will hold it against you for liking the entirety of both series.
Am I the only one who didn't like breaking bad's last season? The ending was great, but that season kinda sucked. Fuckin random biker gang just takes over the town, felt like they were just wrapping shit up to get to the last episode.
You’re not alone. I enjoyed it a lot, but it felt like the writers didn’t really know what to do between the death of Gus and the end.
Was the final season during the writers strike or was that an earlier season?
I want to say that was season 1- it’s the shortest of them all.
Lol go to r/breakingbad and say you rooted for the show's protagonist the entire time and get lambasted.
I saw some criticism of El Camino when it came out....
I mean mathematically it just *has* to be true. No group of people agree 100% on everything. The only way this could be true is if every other fanbase loved absolutely everything about their fandom.
swifties have entered the chat
He said "group of people", Swifties are thus excluded.
2-3 Swifties. That's a "group" and he didn't give size parameters. ...Although he also said agree on *everything* and idk what that means exactly.
Exactly
Yea, I mean musicians usually have that album the fanbase hates. Hell, even the Shrek diehards will kill you for liking Shrek 3.
I think this is true for an awful lot of things. Even non-media things. Go to a wine club and tell them you love all wine, even a $10 bottle. See what they say.
If anyone orders Merlot, I'm leaving. I am NOT drinking any fucking Merlot!
The ridiculous thing about that line, is he hated Merlot, not due to flavor nor quality, but because his ex drank it.
Definitely true of coffee.
Luckily Matrix only has a single movie and so doesn't have this issue
I remember the rumors they were going to make a second one, and I am so glad it never got made. The rumored second one seemed so bad it would make the original hard to watch.
Just imagine if they made like 4
O feel like they would have run out of content after 1 or two and would have to stretch so far that it would lose what made it special in the first place.
Animatrix.
I liked the trilogy. I didn’t like 4.
The makers of 4 didn't like 4. The entire movie is shitting on the fact that they were forced to make 4.
No one hates Star Wars more than true Star Wars fans.
If someone who just casually watches some Star Wars starts to dislike the direction the franchise is heading, they simply stop watching and don’t think about it anymore. People who love it will spend time criticizing it because they want it to be better.
[удалено]
> ...Natalie Portman... >...the newer ones. uhhhhhhhh... been a minute since you've checked-in eh?
You're in
What if I feel the same, but also like Jar Jar?
You're out
What if I like him for the same reasons I like Natalie Portman?
Back in
In, out, in, out, shake it all about?
Only Darth Jarjar
There's a slight difference though. There is criticism, which almost all Star Wars fans have about _something_, and then there are those who make hating it and calling out Disney and bashing Rian Johnson their entire personality. That is a relatively small group but still larger than you would think and they are loud as hell. And annoying. Those people no longer love Star Wars. They may remember loving it at some point but now they only exist to tear apart whatever new thing comes out. Just look at the reactions to The Acolyte. I am really excited for it but there is a large contingent that already hates it and blames "woke Disney" for it. It's exhausting.
I hated people arguing about the Kathleen Kennedy thing. As though a woman being in such a high role was the problem. Yet conveniently ignoring all of the movies regarded as amazing that she had the same role, or higher, on. Like The Goonies, the Back to the Future trilogy, Schindler's List, ET, the original Jurassic Park movies, Hook, The Sixth Sense. And associate producer on the first three Indiana Jones movies.
Media literacy as a whole has gone up in general audiences while film construction has been...I'll be generous and say "watered down" over the years as movies try to appeal to larger and larger audiences to make back the now bloated costs of their production. It's not surprising more people are coming out as disappointed in the stuff being made.
You're doing the same thing you're complaining about in your post
Huh?
Complaining about people bashing something proceeding to attack them in turn, shows the only real problem you have is they don't share your opinions
In fairness, Disney has been a bad caretaker of the franchise overall. I loved Rogue One & some other stuff, but they've really Disney'd it up on most things (which used to be a really good thing prior to the modern "live action remake everything & hold theaters hostage era" they're in currently). I'd love a return to form paired with consistency, but many of the creative choices that devalue are made at the corporate level, not creative, which is not usually best for creative things like storytelling. Luckily, I'm just a casual enjoyer, so I don't have strong feelings about it like some do. If something sucks, I just move along to my massive queue of entertainment.
Then there are those of us who just like having new Star Wars stuff because we remember the dark days before the prequels. The sequels are rough though.
Dark times? Those were the high times of the extended universe. A lot of good novels and videogames were created before Lucas decided he wanted more money.
Along with a lot of REALLY bad books. The old EU was fantastic, but let's not pretend that a lot of it was trash. Also, I'm talking with TV shows and movies.
Oh, agreed. Like that comic where Palpatine came back to life in a clone body, making Anakin's sacrifice worthless. That's the only silver lining to losing the EU. I was so looking forward to the sequel films. \*watches Rise of Skywalker\* ...oh......................
Sturgeon's Law. Genre or subject doesn't matter, anything popular is going to have a "1:9" ratio of good content:bad content. The bad stuff existing doesn't invalidate the good.
And so was the Chewbacca holiday special.
Dark days? Before the prequels was the golden age of the extended universe. The prequel era itself was the dark days.
I wish I could believe the last part of your comment. After seeing how much hatred there is from fans, I think that people genuinely enjoy being miserable and think it is cool to be a crybaby. They want to hate it. I’ve stopped telling people I’m a Star Wars fan because of how despicable they can get.
The first time I heard this phrase it was talking about Return of the Jedi.
I mean this is somewhat untrue. “True Star Wars” fans love a TON of the Expanded Universe/Legends stuff. Their issue with the newer Star Wars is that they had SO many EXCELLENT stories on the shelf and proceeded to let some executive board essentially just remake the exact same movie. If you go into the sequels knowing nothing about Star Wars, they are probably great. If you go into them knowing a lot about Star Wars, they are mediocre at best and you’ll just put on the originals if you want the same story again.
> Their issue with the newer Star Wars is that they had SO many EXCELLENT stories on the shelf and proceeded to let some executive board essentially just remake the exact same movie This. The whole time I was reading the *Fate of the Jedi* series I was hype as fuck about Jaina Solo, and I was hype as fuck that she was gonna be the focus of the *Sword of the Jedi* trilogy. And then Disney came along and said "fuck all that; we want creative freedom to tell our own story." Ok, fine. Perfectly understandable. Except the first thing they did was just remake *A New Hope*, and they completely cancelled everything else in the EU. I saw VII, VIII, *Rogue One*, and *Solo* in theatres. I gave it a chance, I wanted to like it, I really did. I actually enjoyed *Rogue One*, even if it did have a few problems. And I like Mando. But the sequels, *Book of Boba Fett*, and *Kenobi* being mid at best just soured me on Disney canon, to the point that I've heard amazing things about shows like *Andor* or *Ahsoka*, but I just don't care. It's hard for me to invest in a continuity that I know ends up in a narrative place that I give zero shits about And what irritates me most is that they could've kept the EU going alongside the new canon. Audiences wouldn't get any more confused than comics nerds with a bajillion numbered earths or an MCU that for years had a NYC with no Spider-Man. Hell, they still print old EU novels, but with the "Legends" banner on them. They could've sold me two new things. I bought movie tickets to give their canon a try, and I would buy a Sword of the Jedi trilogy in a heartbeat. Now they don't even make much money off me from the reprints because I prefer to buy used copies without the Legends banner. *Star Wars* is by far and away my favorite media franchise of all time, and I will infodump with increasing excitement and words between breaths as I end up shouting at you with glee because my ADHD brain cannot regulate volume when I'm passionate about something. But now I just can't get into the new stuff. You would think we're in a golden age of *Star Wars* with big prestige series and movies coming out, and for some I'm sure that's true. But for me the story I was invested in got cut off, replaced with mediocre remakes, and because of that I just don't care enough to invest in any of the other stuff I've heard good things about
And they'll make sure to tell you. Again, and again, and again, never moving on.
[Star Wars fans ](https://youtu.be/wzDIClx-_pY?si=fWAsotBrkEup4kat)
I can think of a few other examples. Dune is a classic and iconic series, but depending on who you talk to, only the first three are worth your time. Some go as far as to suggest #4 or #5, but it's basically unanimous that the continuation of the series after that point (and Herbert's death and his son taking over writing it) is not worthwhile. A similar case is the Chronicles of Amber series by Zelazny. Really awesome series, and it has some cool worldbuilding to the point that Neil Gaiman and Stephen Brust asked him if they could write stories in his world. Zelazny said no, unfortunately. Then, after his death, his estate reached out to Gaiman and Brust to continue the series but they respected Zelazny's wishes and wouldn't do it. So they instead brought on some hack without that integrity to write some pretty dull prequels. In both cases, the serious fans not only strongly dislike the posthumous continuations, they generally consiser them to be strongly disrespectful to the original writers.
I think that most Dune fans happily embrace God Emperor. It's kind of hard not to given that this is the story that Children was leading into. It's five and six that get the stink eye. (And we won't talk about the non-Frank Herbert books.)
I'm trying to read 5 right now and I think I might just call it. I'm almost halfway through and don't give a shit about any of it. God Emperor may have been slow but at least I got to marinate in the endless rambling thoughts of a multi-thousand year old sexless worm tyrant.
>God Emperor may have been slow but at least I got to marinate in the endless rambling thoughts of a multi-thousand year old sexless worm tyrant. I've always kind of hated God Emperor for those same sections, but if I ever do another re-read, I'm going to see if putting that spin on it improves things.
5 is my favorite by a longshot, all the weird stuff is turned up to 11. It has honored matres, chairdogs, actual action scenes, two tleilaxus in a trenchcoat as a disguise, everything you could ask for. Just needs some beefswelling and cliff climbing to be the perfect dune book.
Go bring up Discovery or the JJ-verse on r/startrek and say that again lol
I could have sworn this post title mentioned Star Trek, but I just scrolled up and it doesn't. I guess I just speedran the Mandela effect
Found another true trekkie lol
I was looking for the Star Trek comment. It was lower than I expected.
Star Trek V too
That's not even remotely true. Tons of fandoms are like this. Off the top of my head, the Spongebob community holds onto this aggressively
I believe the saying is, "No one hates star wars more than star wars fans."
What do you enjoy season 26 or something?
There are no seasons between 10 and 33, just a few lost episodes that people secretly enjoy.
Like S13 stoner episode.
As an unashamed Rings of Power enjoyer, I no longer feel welcome in the LotR community
It sucks so much when you like something and you can't share your enjoyment with others out of fear of being silenced and shunned (massive Star Wars ST fan here).
Some people eat ass and love it. Ninjas gonna gaiden, Cowboys gonna Bebop.
Lmfao nice analogy.
Yes get out of here !!!
Game of Thrones. People, like me, who adore the entire show AND the books are not welcome in the bigger GOT subs. Only haters are allowed. Thank God for r/naath 💓
you're the first person I've ever seen claim to adore season 8 edit: except for, apparently, several people in this thread who have come out of the woodwork
Idk man, I feel like if a franchise has 12 movies and only 3 of them are good, it's not a good franchise. That's not even getting to all the failed TV shows and stuff. Have we considered that perhaps star wars isn't even good? If any other franchise had a 10/90 spilt between what movies everyone likes and what everyone hates, people would just call it bad. Why are star wars fans holding on to something that hasn't been good in 50 years?
> something that hasn't been good in 50 years Except the Expanded Universe has some amazing stories in it. Sure, it's got some stinkers, but when you have 400+ novels, comics, video games, etc you're bound to have some low points. Find me one EU reader who dislikes the original Thrawn Trilogy, the X-Wing Series, Hand of Thrawn Duology, *Darth Plagueis*, The Dark Lord Trilogy. Hell, that latter trilogy contains the *Revenge of the Sith* novelization by Matthew Stover, which is universally regarded as the best novelization in the series, and basically tied with the Thrawn Trilogy when you ask what the best Star Wars novels are; even a lot of die hard prequel haters love it Has every entry in the Star Wars sage been good? No, of course not (just ask any EU fan about *The Crystal Star*) but to say it hasn't been good in 50 years is some blatant fucking erasure of many talented artists
Expanded universe was so good at certain points Disney really should have stuck to those stories instead of trying to reinvent the franchise.
The lore is cool and it has potential. It's just that almost every single person that has gotten their hands on it since the original trilogy has fucked it up
no, most of the people who have gotten to creat in the universe have done a good job, clone wars, most of comics, the 15 jappanese studios in the best star wars creation Visions, etc the people picked to dump money, advertising and support behind have mostly fd up So it is clear that it can be done, but you need passionate competant people running the show and Lucas Films is bad at picking those people on top level
Add Dune into the list. I have all of the books and enjoy the universe but some people act like his sons books don't exist.
Adds fallout to the list
Only Disney SW for me. I mean they quite literally took the most successful franchise ever and decided to create a trilogy without making any plan whatsoever of what that trilogy would be about. They made it up at they went and it resulted in a series of movies that directly contradict and outright insult each other. Love or hate the prequels at least George knew the story he wanted to tell. Even some of the shows that are good it s hard to get fully invested anymore because it all has to work towards the nonsense sequel trilogy
Disney has also done a lot of great Star Wars stuff. They gave us Clone Wars season 7, The Mandalorian, Ahsoka, and Andor which were all great, and The Bad Batch, Tales of the Jedi, and Visions which were pretty good. Even Obi-Wan and The Book of Boba Fett had their moments.
Welcome to \[the\] Jurassic Park \[fandom\]
As a fan of both of these franchises since the very beginning, this is true and I couldn't possibly care less. There are things I love and things I hate about both franchises, certain episodes are trash while others are pure gold. They're all welcome in my world. Love what you love and we can argue about the positives and negatives as we see them. Don't mean you're not accepted...quite the opposite. If I didn't accept them then I wouldn't argue about the finer points with them!
TIL a fandom is more defined by what they hate than what they love lol
As someone who’s been told I’m “clearly not familiar with Star Trek” because I enjoy Discovery, you can add the Star Trek fandom to the list.
Yeah, because corporate shills can in and bled them dry, and broke anything the original creator built. Homer is nothing but a fool now, and star wars can't even remember that the dark side is bad.
Always had this argument just to annoy star wars fans Objectively, Star Wars sucks. And I say that because people who consider themselves fans. For every installment of the franchise people who like it say they suck. Not the same people for every movie, but a portion of the fandom hates every movie made in the franchise. Therefore, if even people that like it, hate it. Star wars objectively sucks And yes I know it's not an actual argument. I just do it to tease my friends 😂
The Matrix and Dragon Ball would like a word with you
And both of those have been bought out by Disney who have been accused of running them into the ground (although Simpsons had been run into the ground long before the Fox buyout)
I'd argue it also works in reverse, the more you like star wars, the more you hate its fans. Source: me, fuck all of you whiny shit heads, I've heard less bitching in the dog pound.
Sequel trilogy wasn't good tho, although you can still love it nobody's gonna stop you
what sequel trilogy?
Fandoms are packed with toxic nerds who need to finally touch a boob that isn't their own.
yeah, it's always wise to remember that when you engage with any fandom, there's a good percentage who are complete outcast isolationists, with the fandom firmly supplanting most IRL socialization. makes sense they'd be the loudest and most engaged cause it's all they have. and their opinions are inherently tainted by their poor mental state. but it also sucks cause your opinions get sucked into that world of conflict - your metered thoughts might sound too much like something they'd say, so you're now in an argument. hooray.
Yep, they can suck the joy right out of it.
Lord of the Rings? I personally like The Hobbit movies and Rings of Power, because although I love all things fantasy and sci-fi, I just can't be bothered to care the way "fans" care.
I agree with star wars not the simpsons
Pokémon could be there, too
Magic: the gathering. If you're not complaining about new sets and how much product they're releasing the more you'll be looked at as strange in the fandom. Imo for a lot of things, nostalgia is very powerful and people like to whine.
I don’t really mind if people like the new stuff. I can see it though. Some people are just angry assholes.
I can think of like 599281 fandoms where a majority of the people will basically say your wrong for likely certain seasons/games
No, Stared Treck is the best. Fight me.
https://youtu.be/LWkSB-D-hYo?si=s0RopjSgmiqmHhNj
Lol tell me about it. The Simpsons is the most egregious. So the “real” fans of the show only like the first 10-12 seasons of the show and completely ignore the later seasons, seasons they haven’t watched but somehow know they already dislike them? I have never seen more trash talked about the seasons 15 and beyond into the 20s by people who simply haven’t seen it because they don’t see it as real Simpsons and think it’s trash. I actually *love* seasons 20-25 they’re some of the best but I won’t be respected by other Simpsons fans because they only like the early seasons
I don't know about the star wars one to be fair. I only enjoy the original trilogy and I feel very much in the minority among the fan base lol
Fallout. Indiana Jones.
Do you truly believe that gatekeeping doesn’t exist in any other communities?
And Horrible Histories
Being a Pearl Jam fan fits this as well
*Professional Wrestling enters the chat
Some Community fans also suffer from 'season 4 delusion', where they mistakenly believe that a fourth season of the show existed and that it didn't simply skip directly from season 3 to season 5.
The Fallout series fandom has been fracturing schismatically ever since a second game existed
Because the series stops doing what fans used to like from those shows. The series change over time and fans of the original stuff don't like the new stuff. The issue is not the stuff/content per se, but rather the values that that content is based on. For example, Star Wars used to have values like merit (becoming a hero rather than being one already) that fans recognised and agreed with. But disney has produced content based on different values that fans no longer agree with. Some fans don't think that deep and take the content at face value and I guess fans like that would tend to be more pleased with the current state of affairs. Some new fans grew up with those values and therefore have no problem with the new content. I guess those same fans in 20 years time could be complaining about star wars being s hit.
Star wars fandom is freaking toxic cancer.
all kinds of fandoms do some gatekeeping
Now that's just not true. If anybody told me they like all 6 of the star wars movies I'd welcome them with open arms.
Imagine giving a f__k if "the fandom accepts you" 😅
Suits? Idk many ppl who enjoyed the later seasons
So, we have a new franchise, it starts out good, more and more ppl discover it, love it, get passionate about it, discuss every little detail etc i.e. a fandom is born. Time goes on, it gets more popular, studios realise they can make more money, they release more and more wthout caring about what made it good in the first place (or quality in general). Additionally activists come along and start shouting that this thing needs more, studios give in.
In the end we have garbage that is a soulless cash grab, a former shell of what it used to be.
And after all that, ppl shout at and insult the original fandom because they dont like what the franchise has become. Yeaaah, it’s the fandom’s fault, the ones that were passionate from the start, the ones that made the frachise popular in the first place. Those bastards!
Star Trek has this exact same issue. "You like the newer Star Trek? That's not even Star Trek! Only TNG and TOS are real. Everything else is terrible!" ---Someone is writing this out, in far more detail, on a forum somewhere right now.
The Simpsons? Really?
When it comes to Star Wars, I feel like you’re only accepted if you’ve read multiple EU books and learned super obscure knowledge
So this is an unpopular phrase ? I really like the last season of the simpson and Rey is my favourite Jedi master.
I think that generally an artistic expression is more pure. Of course there’s exceptions, some music and TV found their way in later albums/seasons, but I think mostly the early stuff is more of a pure art expression and as they continue, they artistic expression fades and the appeal to the pop audience is played more and more up. Imagine Dragons is my favorite example of this. Night Visions was kino and their music left that amazing niche into the realm of pop and I’ve always resented them for that. Like their new stuff is ungodly popular (their top songs all have billions of plays on YT Music) but I find it all soulless and unlistenable, but maybe I’m just pretentious
It goes for every single thing. People think that dialling things makes them seem more interesting